Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Biological sex identification in the endangered dusky gopher frog ( Lithobates sevosa ): a comparison of body size measurements, secondary sex characteristics, ultrasound imaging, and urinary hormone analysis methods

doi: 10.1186/s12958-016-0174-9

Figure Lengend Snippet: Comparison of accuracy for each tested sex identification method

Article Snippet: Assay data and validation tests were analyzed using the free online analysis program MyAssays (MyAssays Ltd., Brighton, Sussex, UK), using the Arbor Assays testosterone and estrone EIA data templates or with GraphPad Prism 6 (Version 6.03, GraphPad Software, Inc., La Jolla, CA).

Techniques: Comparison

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Biological sex identification in the endangered dusky gopher frog ( Lithobates sevosa ): a comparison of body size measurements, secondary sex characteristics, ultrasound imaging, and urinary hormone analysis methods

doi: 10.1186/s12958-016-0174-9

Figure Lengend Snippet: Results of parallelism validation tests for testosterone and estrone enzyme immunoassays

Article Snippet: Assay data and validation tests were analyzed using the free online analysis program MyAssays (MyAssays Ltd., Brighton, Sussex, UK), using the Arbor Assays testosterone and estrone EIA data templates or with GraphPad Prism 6 (Version 6.03, GraphPad Software, Inc., La Jolla, CA).

Techniques: Biomarker Discovery

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Biological sex identification in the endangered dusky gopher frog ( Lithobates sevosa ): a comparison of body size measurements, secondary sex characteristics, ultrasound imaging, and urinary hormone analysis methods

doi: 10.1186/s12958-016-0174-9

Figure Lengend Snippet: Comparison of mean testosterone (panel a ) and mean estrone (panel c ) concentrations for male and female DGFs. There was a significant difference in the mean concentration of testosterone (*, p < 0.05) and estrone (*, p < 0.05) between the sexes. Boxplots for each hormone are in panels b (testosterone) and d (estrone), with shaded regions depicting the quartile 1 to quartile 3 ranges, while whiskers indicate the 90th and 10th percentile. Dark circles indicate outliers beyond this range. The horizontal line within the box represents the median

Article Snippet: Assay data and validation tests were analyzed using the free online analysis program MyAssays (MyAssays Ltd., Brighton, Sussex, UK), using the Arbor Assays testosterone and estrone EIA data templates or with GraphPad Prism 6 (Version 6.03, GraphPad Software, Inc., La Jolla, CA).

Techniques: Comparison, Concentration Assay

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Biological sex identification in the endangered dusky gopher frog ( Lithobates sevosa ): a comparison of body size measurements, secondary sex characteristics, ultrasound imaging, and urinary hormone analysis methods

doi: 10.1186/s12958-016-0174-9

Figure Lengend Snippet: Scatterplot showing the sex of the DGFs can be distinguished by the ratio of urinary testosterone to estrone. Data shown are log transformed. Blue circles indicate males, while females are indicated by pink squares

Article Snippet: Assay data and validation tests were analyzed using the free online analysis program MyAssays (MyAssays Ltd., Brighton, Sussex, UK), using the Arbor Assays testosterone and estrone EIA data templates or with GraphPad Prism 6 (Version 6.03, GraphPad Software, Inc., La Jolla, CA).

Techniques: Transformation Assay

Journal: Neurotoxicology and teratology

Article Title: Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner

doi: 10.1016/j.ntt.2016.10.004

Figure Lengend Snippet: mRNA qPCR Primer Pairs

Article Snippet: Gene target fold expression values were obtained using the comparative CT method [ 36 ], and statistical analysis was conducted on GraphPad Prism 6 Software, version 6.03 (GraphPad Software, San Diego, CA). table ft1 table-wrap mode="anchored" t5 caption a7 Endogenous Control Gene Gene Gene ID Forward Sequence Reverse Sequence Source Hprt 15452 set a TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [ 17 ] set b AAGACTTGCTCGAGATGTCATGAA ATCCAGCAGGTCAGCAAAGAA [ 8 ] Target Genes Gene Gene ID Forward Sequence Reverse Sequence Source Rest 19712 CATGGCCTTAACCAACGACAT CGACCAGGTAATCGCAGCAG 33859606a1 Co- Rest 217864 GTGCCCGACTTCGATCCTG GATGTACTCGTCCAGTTTTGCT 27503810a1 Ptbp1 19205 CACACCCCAAAGCCTCTTTAT ATCTGCACAAGTGCGTTCTCC 26331660a1 Ptbp2 56195 ATGGACGGAATTGTCACTGAGG TGCCACTCATATTAGAGTTGGGG 9507003a1 Sex Determination Gene Gene Gene ID Forward Sequence Reverse Sequence Source Sry 21674 GCTGGGATGCAGGTGGAAAA CCCTCCGATGAGGCTGATATT PrimerBank ID: 6755761a1 microRNA qPCR Primer/Probe Assays Endogenous Control Gene Gene Gene ID Assay Name Snord68 100302565 mmu-snoRNA202 Target miRNA miRNA Accession miRBase ID Assay Name Mature miRNA Sequence miR-9 MIMAT0000142 mmu-miR-9-5p hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA miR-9* MIMAT0000143 mmu-miR-9-3p mmu-miR-9-3p AUAAAGCUAGAUAACCGAAAGU miR-18a MIMAT0000528 mmu-miR18a-5 hsa-miR18a UAAGGUGCAUCUAGUGCAGAUAG miR-124 MIMAT0000134 mmu-miR-124-3p mmu-miR-124a UAAGGCACGCGGUGAAUGCC Open in a separate window mRNA qPCR Primer Pairs Quantitative PCR assessment of microRNA expression Ten ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (cat: 4366596; Life Technologies) using primer sets for TaqMan® MicroRNA Assay (cat: 4427975; Life Technologies) for miR-9, miR-9*, miR-18, and miR-124 according to the manufacturer’s instructions ( ).

Techniques: Sequencing

Journal: Neurotoxicology and teratology

Article Title: Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner

doi: 10.1016/j.ntt.2016.10.004

Figure Lengend Snippet: Prenatal exposure to 50 ppb arsenic does not impact the expression of microRNA-9 in the (A) female brain at embryonic day 14 nor in the (B) female brain at embryonic day 18. Prenatal arsenic exposure significantly decreases miR-9 expression in the (C) male brain at embryonic day 14, but this effect is lost in the (D) male brain at embryonic day 18. A similar pattern is observed for microRNA-9* (the passenger strand for miR-9). Prenatal exposure to 50 ppb arsenic does not impact the expression of miR-9* in the (E) female brain at embryonic day 14 nor in the (F) female brain at embryonic day 18. Prenatal arsenic exposure significantly decreases miR-9* expression in the (G) male brain at embryonic day 14, but this effect is lost in the (H) male brain at embryonic day 18.

Article Snippet: Gene target fold expression values were obtained using the comparative CT method [ 36 ], and statistical analysis was conducted on GraphPad Prism 6 Software, version 6.03 (GraphPad Software, San Diego, CA). table ft1 table-wrap mode="anchored" t5 caption a7 Endogenous Control Gene Gene Gene ID Forward Sequence Reverse Sequence Source Hprt 15452 set a TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [ 17 ] set b AAGACTTGCTCGAGATGTCATGAA ATCCAGCAGGTCAGCAAAGAA [ 8 ] Target Genes Gene Gene ID Forward Sequence Reverse Sequence Source Rest 19712 CATGGCCTTAACCAACGACAT CGACCAGGTAATCGCAGCAG 33859606a1 Co- Rest 217864 GTGCCCGACTTCGATCCTG GATGTACTCGTCCAGTTTTGCT 27503810a1 Ptbp1 19205 CACACCCCAAAGCCTCTTTAT ATCTGCACAAGTGCGTTCTCC 26331660a1 Ptbp2 56195 ATGGACGGAATTGTCACTGAGG TGCCACTCATATTAGAGTTGGGG 9507003a1 Sex Determination Gene Gene Gene ID Forward Sequence Reverse Sequence Source Sry 21674 GCTGGGATGCAGGTGGAAAA CCCTCCGATGAGGCTGATATT PrimerBank ID: 6755761a1 microRNA qPCR Primer/Probe Assays Endogenous Control Gene Gene Gene ID Assay Name Snord68 100302565 mmu-snoRNA202 Target miRNA miRNA Accession miRBase ID Assay Name Mature miRNA Sequence miR-9 MIMAT0000142 mmu-miR-9-5p hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA miR-9* MIMAT0000143 mmu-miR-9-3p mmu-miR-9-3p AUAAAGCUAGAUAACCGAAAGU miR-18a MIMAT0000528 mmu-miR18a-5 hsa-miR18a UAAGGUGCAUCUAGUGCAGAUAG miR-124 MIMAT0000134 mmu-miR-124-3p mmu-miR-124a UAAGGCACGCGGUGAAUGCC Open in a separate window mRNA qPCR Primer Pairs Quantitative PCR assessment of microRNA expression Ten ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (cat: 4366596; Life Technologies) using primer sets for TaqMan® MicroRNA Assay (cat: 4427975; Life Technologies) for miR-9, miR-9*, miR-18, and miR-124 according to the manufacturer’s instructions ( ).

Techniques: Expressing

Journal: Neurotoxicology and teratology

Article Title: Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner

doi: 10.1016/j.ntt.2016.10.004

Figure Lengend Snippet: Prenatal exposure to 50 ppb arsenic does not alter miR-124 expression in the female brain at (A) embryonic day 14 nor at (B) embryonic day 18. Prenatal arsenic exposure significantly decreases miR-124 expression in the (C) male brain at embryonic day 14, but this effect is lost at (D) embryonic day 18. These effects are specific to miR-124, as prenatal exposure to 50 ppb arsenic does not alter the expression of microRNA-18 in the (E) female brain at embryonic day, the (F) female brain at embryonic day 18, the (G) male brain at embryonic day 14, and the (H) male brain at embryonic day 18.

Article Snippet: Gene target fold expression values were obtained using the comparative CT method [ 36 ], and statistical analysis was conducted on GraphPad Prism 6 Software, version 6.03 (GraphPad Software, San Diego, CA). table ft1 table-wrap mode="anchored" t5 caption a7 Endogenous Control Gene Gene Gene ID Forward Sequence Reverse Sequence Source Hprt 15452 set a TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [ 17 ] set b AAGACTTGCTCGAGATGTCATGAA ATCCAGCAGGTCAGCAAAGAA [ 8 ] Target Genes Gene Gene ID Forward Sequence Reverse Sequence Source Rest 19712 CATGGCCTTAACCAACGACAT CGACCAGGTAATCGCAGCAG 33859606a1 Co- Rest 217864 GTGCCCGACTTCGATCCTG GATGTACTCGTCCAGTTTTGCT 27503810a1 Ptbp1 19205 CACACCCCAAAGCCTCTTTAT ATCTGCACAAGTGCGTTCTCC 26331660a1 Ptbp2 56195 ATGGACGGAATTGTCACTGAGG TGCCACTCATATTAGAGTTGGGG 9507003a1 Sex Determination Gene Gene Gene ID Forward Sequence Reverse Sequence Source Sry 21674 GCTGGGATGCAGGTGGAAAA CCCTCCGATGAGGCTGATATT PrimerBank ID: 6755761a1 microRNA qPCR Primer/Probe Assays Endogenous Control Gene Gene Gene ID Assay Name Snord68 100302565 mmu-snoRNA202 Target miRNA miRNA Accession miRBase ID Assay Name Mature miRNA Sequence miR-9 MIMAT0000142 mmu-miR-9-5p hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA miR-9* MIMAT0000143 mmu-miR-9-3p mmu-miR-9-3p AUAAAGCUAGAUAACCGAAAGU miR-18a MIMAT0000528 mmu-miR18a-5 hsa-miR18a UAAGGUGCAUCUAGUGCAGAUAG miR-124 MIMAT0000134 mmu-miR-124-3p mmu-miR-124a UAAGGCACGCGGUGAAUGCC Open in a separate window mRNA qPCR Primer Pairs Quantitative PCR assessment of microRNA expression Ten ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (cat: 4366596; Life Technologies) using primer sets for TaqMan® MicroRNA Assay (cat: 4427975; Life Technologies) for miR-9, miR-9*, miR-18, and miR-124 according to the manufacturer’s instructions ( ).

Techniques: Expressing

Journal: Neurotoxicology and teratology

Article Title: Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner

doi: 10.1016/j.ntt.2016.10.004

Figure Lengend Snippet: Comparisons for baseline expression of microRNAs were assessed in unexposed female and male mice at both embryonic day 14 and embryonic day 18. No differences in expression of miR-9, miR-9*, nor miR-18 at embryonic day 14 and embryonic day 18 were observed between the sexes. However, microRNA-124 expression is increased in males compared to females at embryonic day 14.

Article Snippet: Gene target fold expression values were obtained using the comparative CT method [ 36 ], and statistical analysis was conducted on GraphPad Prism 6 Software, version 6.03 (GraphPad Software, San Diego, CA). table ft1 table-wrap mode="anchored" t5 caption a7 Endogenous Control Gene Gene Gene ID Forward Sequence Reverse Sequence Source Hprt 15452 set a TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [ 17 ] set b AAGACTTGCTCGAGATGTCATGAA ATCCAGCAGGTCAGCAAAGAA [ 8 ] Target Genes Gene Gene ID Forward Sequence Reverse Sequence Source Rest 19712 CATGGCCTTAACCAACGACAT CGACCAGGTAATCGCAGCAG 33859606a1 Co- Rest 217864 GTGCCCGACTTCGATCCTG GATGTACTCGTCCAGTTTTGCT 27503810a1 Ptbp1 19205 CACACCCCAAAGCCTCTTTAT ATCTGCACAAGTGCGTTCTCC 26331660a1 Ptbp2 56195 ATGGACGGAATTGTCACTGAGG TGCCACTCATATTAGAGTTGGGG 9507003a1 Sex Determination Gene Gene Gene ID Forward Sequence Reverse Sequence Source Sry 21674 GCTGGGATGCAGGTGGAAAA CCCTCCGATGAGGCTGATATT PrimerBank ID: 6755761a1 microRNA qPCR Primer/Probe Assays Endogenous Control Gene Gene Gene ID Assay Name Snord68 100302565 mmu-snoRNA202 Target miRNA miRNA Accession miRBase ID Assay Name Mature miRNA Sequence miR-9 MIMAT0000142 mmu-miR-9-5p hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA miR-9* MIMAT0000143 mmu-miR-9-3p mmu-miR-9-3p AUAAAGCUAGAUAACCGAAAGU miR-18a MIMAT0000528 mmu-miR18a-5 hsa-miR18a UAAGGUGCAUCUAGUGCAGAUAG miR-124 MIMAT0000134 mmu-miR-124-3p mmu-miR-124a UAAGGCACGCGGUGAAUGCC Open in a separate window mRNA qPCR Primer Pairs Quantitative PCR assessment of microRNA expression Ten ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (cat: 4366596; Life Technologies) using primer sets for TaqMan® MicroRNA Assay (cat: 4427975; Life Technologies) for miR-9, miR-9*, miR-18, and miR-124 according to the manufacturer’s instructions ( ).

Techniques: Expressing

Journal: Neurotoxicology and teratology

Article Title: Prenatal arsenic exposure alters REST/NRSF and microRNA regulators of embryonic neural stem cell fate in a sex-dependent manner

doi: 10.1016/j.ntt.2016.10.004

Figure Lengend Snippet: During development of the central nervous system, the REST/NRSF complex (containing Rest and Rcor1 proteins) promotes the self-renewal and maintenance of the neural stem cell niche by inhibiting the transcription of proneural genes in neural stem cells. Additionally, alternative splicing of pro-neural genes, like Pbx1a, is repressed by the RNA binding protein Ptbp1 (and occasionally Ptbp2). Ptbp2 fine-tunes the regulation of neurogenesis, overall promoting neural gene splicing and the differentiation of neural progenitor cells, and is negatively regulated by Ptbp1. Expression of the microRNAs miR-9 and miR-124 occurs during neural induction and leads to neuronal differentiation. These microRNAs miR-9 and miR-124 contain RE-1 sequences for negative regulation via the REST/NRSF complex; in turn, the Rest genes contains binding sites for miR-9 and miR-124, resulting in a feedback regulatory loop. Exposure to 50 ppb arsenic during development increases the expression of Rest, Rcor1, and Ptbp1, likely due to decreased expression of miR-9 and miR-124 at embryonic day 14 in the male fetal brain (red arrows). Direct downstream targets of this regulatory loop are impacted: arsenic exposure reduces expression Pbx1a (red arrow) and increases expression of Pbx1b (red arrow) in males at embryonic day 14. At embryonic day 18 these effects are mitigated and Rcor1 expression is increased in the male brain (blue arrow). In the female brain at embryonic day 14, both Rcor1 and Ptbp2 expression are increased, with no effect on microRNA expression. Prenatal arsenic likely induces precocious differentiation, as indicated by increased neuroblast formation (purple arrow) in the females at embryonic day 14, perhaps through a different regulatory mechanism than REST/CoREST complex. No effects of arsenic were observed at embryonic day 18 in the female brain. For males, prenatal arsenic exposure inhibits expression of pro-neural genes and neurogenic processes at embryonic day 14 in the male brain, likely leading to reduced differentiation of neural progenitor cells as indicated by decreased formation of neuroblasts (red arrow).

Article Snippet: Gene target fold expression values were obtained using the comparative CT method [ 36 ], and statistical analysis was conducted on GraphPad Prism 6 Software, version 6.03 (GraphPad Software, San Diego, CA). table ft1 table-wrap mode="anchored" t5 caption a7 Endogenous Control Gene Gene Gene ID Forward Sequence Reverse Sequence Source Hprt 15452 set a TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT [ 17 ] set b AAGACTTGCTCGAGATGTCATGAA ATCCAGCAGGTCAGCAAAGAA [ 8 ] Target Genes Gene Gene ID Forward Sequence Reverse Sequence Source Rest 19712 CATGGCCTTAACCAACGACAT CGACCAGGTAATCGCAGCAG 33859606a1 Co- Rest 217864 GTGCCCGACTTCGATCCTG GATGTACTCGTCCAGTTTTGCT 27503810a1 Ptbp1 19205 CACACCCCAAAGCCTCTTTAT ATCTGCACAAGTGCGTTCTCC 26331660a1 Ptbp2 56195 ATGGACGGAATTGTCACTGAGG TGCCACTCATATTAGAGTTGGGG 9507003a1 Sex Determination Gene Gene Gene ID Forward Sequence Reverse Sequence Source Sry 21674 GCTGGGATGCAGGTGGAAAA CCCTCCGATGAGGCTGATATT PrimerBank ID: 6755761a1 microRNA qPCR Primer/Probe Assays Endogenous Control Gene Gene Gene ID Assay Name Snord68 100302565 mmu-snoRNA202 Target miRNA miRNA Accession miRBase ID Assay Name Mature miRNA Sequence miR-9 MIMAT0000142 mmu-miR-9-5p hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA miR-9* MIMAT0000143 mmu-miR-9-3p mmu-miR-9-3p AUAAAGCUAGAUAACCGAAAGU miR-18a MIMAT0000528 mmu-miR18a-5 hsa-miR18a UAAGGUGCAUCUAGUGCAGAUAG miR-124 MIMAT0000134 mmu-miR-124-3p mmu-miR-124a UAAGGCACGCGGUGAAUGCC Open in a separate window mRNA qPCR Primer Pairs Quantitative PCR assessment of microRNA expression Ten ng of total RNA was reverse transcribed with the TaqMan® MicroRNA Reverse Transcription Kit (cat: 4366596; Life Technologies) using primer sets for TaqMan® MicroRNA Assay (cat: 4427975; Life Technologies) for miR-9, miR-9*, miR-18, and miR-124 according to the manufacturer’s instructions ( ).

Techniques: RNA Binding Assay, Expressing, Binding Assay